9 bind to properties on a dynamic class
Báo cáo khoa học: "A Dynamic Bayesian Framework to Model Context and Memory in Edit Distance Learning: An Application to Pronunciation Classification" ppt
Ngày tải lên :
23/03/2014, 19:20
... is to assume a generative model whereby a word w and a surface pronunciation tn are related via an underlying canonical pronunciation sm of w and a stochastic process that explains the transformation ... probability P (w, sm , tn ) by adding a word RV 1 and a canonical pronunciation RV on top of any of the previous models There are other pronunciation classification approaches with various emphases ... pronunciation classification we are given a lexicon, which consists of words and their corresponding canonical pronunciations We are also provided with surface pronunciations and asked to find the most...
- 8
- 397
- 0
Báo cáo hóa học: " A biofeedback cycling training to improve locomotion: a case series study based on gait pattern classification of 153 chronic stroke patients" pdf
Ngày tải lên :
19/06/2014, 08:20
... walking share a similar kinematic pattern: both tasks are cyclical, require reciprocal flexion and extension movements of hip, knee, and ankle, and have an alternating activation of agonist/antagonist ... participated to study design, data collection and analysis, and manuscript writing; EA participated to study design, data collection and analysis, and manuscript definition; PR participated at data collection; ... biofeedback cycling training to improve locomotion: a case series study based on gait pattern classification of 153 chronic stroke patients Simona Ferrante1*, Emilia Ambrosini1, Paola Ravelli1, Eleonora...
- 13
- 443
- 0
Báo cáo hóa học: " Research Article On a Class of Parametric Transforms and Its Application to Image Compression" ppt
Ngày tải lên :
22/06/2014, 20:20
... automatic generation of transform parameters meaning that the transform may automatically be adapted to the input signal or image CONCLUSION A new class of parametric transforms was investigated ... S Agaian, J Astola, and K Egiazarian, Binary Polynomial Transforms and Non-linear Digital Filters, Marcel Dekker, New York, NY, USA, 1995 [4] S S Agaian and A K Matevosian, “Generalized Haar ... particular interest since they are generalizations of the classical Hadamard and Haar transforms Definition Within the class Ω consider the family Ω of Hadamard-like orthogonal transforms such that all...
- 14
- 484
- 0
Báo cáo hóa học: " Erratum to “A New Class of Particle Filters for Random Dynamic Systems with Unknown Statistics”" pot
Ngày tải lên :
22/06/2014, 23:20
... with emphasis on the topics of Bayesian analysis, sequential Monte Carlo methods, adaptive filtering, stochastic optimization, and their applications to multiuser communications, smart antenna systems, ... in the area of statistical signal processing, and his primary interests are in the theory of modeling, detection, estimation, and time series analysis, and its application to a wide variety of ... 2000 she was with the Departa´ mento de Electronica y Sistemas at the Universidade da Coru˜ a, Spain, where she n worked in interference cancellation applied to multiuser communication systems...
- 2
- 327
- 0
How To Configure Dynamic DNS Server On A Cisco Router doc
Ngày tải lên :
25/07/2014, 08:20
... http://email:password@dynupdate.no-ip.com/nic/update?hostname=&myip= As we said, the login name is your registered email address This means that the full syntax above will contain two '@' characters, which can create a problem with ... the HTTP authentication string is slightly different, and you'll need to adjust your update interval to once a day rather than every minutes The interval adjustment is very important as Dyndns.com ... information to authenticate to the DDNS provider so it can then update the necessary hostname We should note that each DDNS provider uses its own authentication method & parameters In No-ip.com's case,...
- 6
- 810
- 0
Đề cương ôn tập toán 9 do tổ bộ môn khu ba tổng 2 huyện yên dũng biên soạn
Ngày tải lên :
17/10/2013, 06:11
... tam giác ABC vng A có a = 15, B = 600 Giải tam giác ABC? Bài 10:Cho tam giác ABC vng A có AH = 3, C = 400 Giải tam giác ABC? Bài 11: Cho tam giác ABC vng A có c’ = 4, B = 550 Giải tam giác ABC? ... Cho tam giác ABC vng A Biết b = cm, c = cm Giải tam giác ABC Bài 2: Cho tam giác ABC vng A có b’ = 7, c’ = Giải tam giác ABC? Bài 3a: Cho tam giác ABC vng A có b = 4, b’ = 3.2 Giải tam giác ABC? ... Cho tam giác ABC vng A có c = 4, b’ = 3.2 Giải tam giác ABC? Bài 4: Cho tam giác ABC vng A có AH = 4.8, BC =10 Giải tam giác ABC? Bài 5: Cho tam giác ABC vng A có h = 4, c’ = Giải tam giác ABC?...
- 39
- 541
- 1
Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx
Ngày tải lên :
14/02/2014, 14:20
... internalization and whether the rate constants of association and dissociation for [125I]TCPCSK9 at 37 °C are similar to values obtained at °C Our preliminary data indicate that HepG2 cells are able ... data were also analyzed according to the Scatchard method [47] Linear regression analyses of binding data gave dissociation constants (Kd), calculated from the reciprocal of the slopes Association ... course data with a two-exponential association model kobs(rapid) and kobs(slow) are the observed association rate constants for the rapid and slow association phases, respectively The values for...
- 13
- 712
- 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc
Ngày tải lên :
18/02/2014, 04:20
... (cathepsin C): exclusion domain added to an endopeptidase framework creates the machine for activation of granular serine proteases EMBO J 20, 6570–6582 18 Molgaard A, Arnau J, Lauritzen C, Larsen ... structures are almost 10 A apart It is concluded is that the occluding loop is rather flexible and will adapt to structural features of the inhibitors as well as to the packing constraints of the environment ... enzymatic activity The N-terminal trunk binds into the nonprimed Table Average distances between CA atoms of the stefins and catalytic residues of cysteine proteases Distance calculated ˚ d (A) Papain–stefin...
- 8
- 632
- 0
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
Ngày tải lên :
18/02/2014, 13:20
... Selection of the DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 randomized oligonucleotides in the center, i.e CTGTCAGTGAT GCATATGAACGAATN10AATCAACGACATTAGGATC CTTAGC was synthesized A ... expression Plant Mol Biol 24, 701–713 Prabakaran P, An J, Gromiha M, Selvaraj S, Uedaira H, Kono H & Sarai A (2001) Thermodynamic database for protein-nucleic acid interactions (ProNIT) Bioinformatics ... poly.[d (A- T)].poly[dAdT] (Amersham Pharmacia Biotech) gradient of 0.001– 10 lg was added to a final volume of 10 lL of each aliquot After incubation for a further 10 min, the contents were loaded on to an 8% nondenaturing...
- 10
- 464
- 1
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
Ngày tải lên :
19/02/2014, 17:20
... oxidized haem causes a paramagnetic shift on its 2258 C A Salgueiro et al signals that is directly proportional to the fractional oxidation in the absence of extrinsic paramagnetic contributions As ... da Silva JJR, Amorim MTS, Cabral MF, Chaves S & Costa J (1991) Dissociation constants of Bronsted acids in D2O and H2O: studies on polyaza and polyoxa–polyaza macrocycles and a general correlation ... formation Because the thermodynamic parameters for the haems calculated from the NMR data are relative, it could be argued that all haem potentials had been modified to a similar degree but to an...
- 10
- 640
- 0
Đề tài " On a class of type II1 factors with Betti numbers invariants " pdf
Ngày tải lên :
06/03/2014, 08:21
... factors M having HT Cartan subalgebras A ⊂ M , i.e., maximal abelian ∗ -subalgebras A ⊂ M such that M has the property H relative to A and A contains a subalgebra A0 ⊂ A with A0 ∩ M = A and A0 ... always a 2-cocycle, ∀R), there exists a type II1 factor with a Cartan subalgebra (A ⊂ M ) associated with it, via a groupmeasure space construction “` la” Murray-von Neumann The association a (A ... version of this paper I am particularly grateful to Alain Connes and Dima Shlyakhtenko for many fruitful conversations and constant support I want to express my gratitude to MSRI and the organizers...
- 92
- 436
- 0
How to Get on in the World A Ladder to Practical Success doc
Ngày tải lên :
06/03/2014, 18:20
... abilities he was to display Humbert was a scapegrace when a youth; at sixteen he ran away from home and was by turns servant to a tradesman at Nancy, a workman at Lyons, and a hawker of rabbit-skins ... young, imaginative and susceptible, are concerned Man is said to be "an imitative animal." This is certainly true as to early education, and the tendency to imitate remains to a greater or less ... The man of experience learns to rely upon time as his helper "Time and I against any two," was a maxim of Cardinal Mazarin Time has been described as a beautifier and as a consoler; but it is also...
- 111
- 942
- 0
Báo cáo khoa học: Dissociation/association properties of a dodecameric cyclomaltodextrinase Effects of pH and salt concentration on the oligomeric state pot
Ngày tải lên :
07/03/2014, 12:20
... the peak area during the dissociation process The rate of change in the peak area shown in Fig 3A was estimated according to an equation of single exponential decay [7], peak areaịt ẳ Aekt ỵ ... mutant, 5Â-TCTGCTGCAGCA GGGTGTT GAGAAGCGCTGGATG-3Â (forward) and 5Â-CATCCAG CGCTTCTCAACACCCT GCTGCAGCAGA-3Â (reverse); for the H539V mutant, 5Â-CGACAAGGCGGGCGTC ACGTTA ACGCTGCCTGTCC-3Â (forward) ... several minutes Data collection at each substrate concentration was truncated in and another injection was made The thermal power obtained was averaged for 30 s prior to the subsequent injection to...
- 13
- 511
- 0
Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc
Ngày tải lên :
08/03/2014, 04:22
... Conference on Natural Language Learning (CoNLL-2003), page , Edmonton/Canada Gloria V´ zquez, Ana Fern´ ndez, Irene Castell´ n, a a o and M Antonia Mart´ 2000 Clasificaci´ n verı o bal: Alternancias ... grammatical function of the constituents, we have to take into account that the extraction is an approximation There are various phenomena that can lead us to an erroneous extraction of the constituents ... Silhouette measure are the 3-way and 15-way classifications The baseline is calculated, for each task, as the average value of the Adjusted Rand measure for 100 random cluster assignations Although all...
- 6
- 418
- 0
Báo cáo Y học: Assignment of molecular properties of a superactive coagulation factor VIIa variant to individual amino acid changes potx
Ngày tải lên :
08/03/2014, 09:20
... encompassing the second epidermal growth factor-like and serine protease domains, on a MegaBACE 1000 (Amersham Pharmacia Biotech) Activity and inhibition assays The enzymatic activity and inhibition ... Ca2+ This was also the case for V158D-FVIIa, M298Q-FVIIa and V158D/M298QFVIIa In contrast, all FVIIa variants containing the E296V mutation retained a larger fraction of their activity when Ca2+ ... even after conversion to FVIIa the conformational equilibrium appears to be shifted toward an enzymatically latent form Thus, the role of TF, apart from localizing FVIIa to the site of vascular...
- 6
- 301
- 0
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf
Ngày tải lên :
08/03/2014, 22:20
... recombinant allergen after affinity purification using the mAb IG12 [18] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage site after incubation ... wall in vivo This enables expansin activation, accumulation and catalysis under identical pH conditions and explains how expansins may mediate acid growth of plant cell walls Theoretical pI calculations ... obtained from New England Biolabs, Beverly, MA, USA Pichia-transformation, identification of transformants, and expression Transformation of P pastoris strains GS115 and PEP4(thus proteinase A) -deficient...
- 10
- 535
- 0
Báo cáo Y học: A chimeric scorpion a-toxin displays de novo electrophysiological properties similar to those of a-like toxins docx
Ngày tải lên :
08/03/2014, 23:20
... oligonucleotides: 5Â-GGTTA TATTGCCAAGAACTATAACTGTGCATAC-3Â, 5Â-C ATTGTTTAAAAATCTCCTCAGGCTGCGACACTTT A- 3Â, and 5Â-ACGAGTGGCCACTGCGGACATAAATC TGGACACGGAAGTGCCTGCTGG-3Â, respectively Production of ... the action potential durations under BotXIV (A) and the axonal membrane depolarization under M8-10 associated to a slight prolongation of AP duration and a AP amplitude decrease An articial repolarization ... electrophysiological properties partially comparable with those of BomIV, an a- like scorpion toxin Implications of that particular functional anatomy elucidation regarding the classication of a- toxins of...
- 11
- 523
- 0
Báo cáo khoa học: " Teaching a Weaker Classifier: Named Entity Recognition on Upper Case Text" docx
Ngày tải lên :
17/03/2014, 08:20
... second classifier such that provides additional “useful” information that can be utilized by this second classifier, then one can use this second classifier to automatically tag the unlabeled data ... $ hF A Feature InitCapPeriod OneCap F Example Mr F Token satisfies Starts with a capital letter, ends with a period Contains only one capital letter All capital letters and period Contains a digit ... is easily applicable This way of teaching a weaker classifier can also be used in other domains, where the task is to in, and an abundance of unlabeled data fer is available If one possesses a second...
- 8
- 285
- 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
Ngày tải lên :
17/03/2014, 23:20
... 5047–5052 Hoff, C.M & Jacob, S.T (1993) Characterization of the factor E1BF from a rat hepatoma that modulates ribosomal RNA gene transcription and its relationship to the human Ku autoantigen Biochem ... reaction mixture using the RT-PCR kit (Stratagene) PCR amplification was performed using LA Taq (Takara, Japan) in a total volume of 50 lL containing 55 pg of competitor At this concentration, ... specifically to MREa play an important role as a basal regulator of WD gene transcription MATERIALS AND METHODS Cell culture The human hepatoma cell line HepG2 was obtained from KRIBB and grown...
- 11
- 628
- 0